WormBase Tree Display for Variation: WBVar00597561

WBVar00597561 Name: Public_name: tm5275
    Other_name: C36B1.3.1:c.384+21_632+5delinsGA
    HGVSg: CHROMOSOME_I:g.8729274_8729658delinsGA
  Sequence_details: SMap: S_parent: Sequence: C36B1
    Flanking_sequences: atttagacacggtaaatttaaaaaaatgca aactattatcagtattttgtgaatttcgta
    Mapping_target: C36B1
    Source_location: 7 CHROMOSOME_I 8729272 8729659 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AGA
      Deletion
    PCR_product: tm5275_external
      tm5275_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5275
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007971
    Transcript: C36B1.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C36B1.3.1:c.384+21_632+5delinsGA
        Intron_number: 4-5/7
        Exon_number: 5/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 15836/15837-AGA-16222/16223 (386 bp deletion + 3 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele