WormBase Tree Display for Variation: WBVar00597593

WBVar00597593 Name: Public_name: tm5343
    Other_name: F40G12.10.1:c.29_600+15del
    HGVSg: CHROMOSOME_V:g.14283597_14284333del
  Sequence_details: SMap: S_parent: Sequence: F40G12
    Flanking_sequences: AGATGGAAAAGAAAAAATCGAAGACGAAAC ATAAATTTTCGAAATGAAAGTGCAACTCCA
    Mapping_target: F40G12
    Type_of_mutation: Deletion
    PCR_product: tm5343_external
      tm5343_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5343
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009605
    Transcript: F40G12.10.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F40G12.10.1:c.29_600+15del
        cDNA_position: 57-?
        CDS_position: 29-?
        Protein_position: 10-?
        Intron_number: 2-4/7
        Exon_number: 2-4/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 28242/28243-28979/28980 (737 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele