WormBase Tree Display for Variation: WBVar00600816

WBVar00600816 Name: Public_name: tm5415
    Other_name: T03F1.5.2:c.-11+32_315del
      T03F1.5.1:c.-16+32_315del
    HGVSg: CHROMOSOME_I:g.3839117_3839571del
  Sequence_details: SMap: S_parent: Sequence: T03F1
    Flanking_sequences: gttctccggatacttgatcttgaagcagaa tcacatttcgcaacgaaaccctgaaacata
    Mapping_target: T03F1
    Source_location: 7 CHROMOSOME_I 3839116 3839572 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5415_external
      tm5415_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5415
    NBP_allele
    Status: Live
  Affects (2)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0002421 Paper_evidence: WBPaper00049736
        Curator_confirmed: WBPerson1185
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Reference: WBPaper00049736
  Remark: 1264/1265-1719/1720 (455 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele