WormBase Tree Display for Variation: WBVar00600819

WBVar00600819 Name: Public_name: tm5410
    HGVSg: CHROMOSOME_V:g.8461852_8462193del
  Sequence_details: SMap: S_parent: Sequence: T23B12
    Flanking_sequences: gagccattcgaattctctcttctcgattat tagaaaaagacaaaaaattgtttcaattct
    Mapping_target: T23B12
    Source_location: 7 CHROMOSOME_V 8461851 8462194 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5410_external
      tm5410_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5410
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001040
    Transcript: T23B12.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-224
        CDS_position: ?-211
        Protein_position: ?-71
        Intron_number: 2/3
        Exon_number: 1-3/4
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 17288/17289-17630/17631 (342 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele