WormBase Tree Display for Variation: WBVar00600827

WBVar00600827 Name: Public_name: tm3670
    Other_name: Y57G11C.15a.1:c.25_470del
      CE14954:p.Val9CysfsTer32
    HGVSg: CHROMOSOME_IV:g.14823905_14824399del
  Sequence_details: SMap: S_parent: Sequence: Y57G11C
    Flanking_sequences: tcgtcgagaaggaggacgatgagaccggca gaattcaaggaatttaactgaaaaaaacaa
    Mapping_target: Y57G11C
    Source_location: 7 CHROMOSOME_IV 14823904 14824400 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3670_external
      tm3670_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3670
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013311
    Transcript: Y57G11C.15b.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-377
        CDS_position: ?-377
        Protein_position: ?-126
        Intron_number: 1/2
        Exon_number: 1-2/3
      Y57G11C.15a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 186636/186637-187131/187132 (495 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele