WormBase Tree Display for Variation: WBVar00600858

WBVar00600858 Name: Public_name: tm5462
    HGVSg: CHROMOSOME_IV:g.3516696_3517171del
  Sequence_details: SMap: S_parent: Sequence: Y37E11C
    Flanking_sequences: aaagtcacattttgcaaatttctaaagaag cgaagtttttgcccaatttaggagtgaata
    Mapping_target: Y37E11C
    Source_location: 7 CHROMOSOME_IV 3516695 3517172 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5462_external
      tm5462_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5462
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006769
    Transcript: Y37E11C.1a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 1-2/10
        Exon_number: 1-2/11
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 2576/2577-3052/3053 (476 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele