WormBase Tree Display for Variation: WBVar00600862

WBVar00600862 Name: Public_name: tm5472
    Other_name: CE53914:p.Ala112_Lys208delextTer?
      Y51H7C.11.1:c.326_616del
    HGVSg: CHROMOSOME_II:g.1436717_1437072del
  Sequence_details: SMap: S_parent: Sequence: Y51H7C
    Flanking_sequences: accacaacattcgttgattgaattttggcg gaatttcaatgaaaatttgttgcccttttt
    Mapping_target: Y51H7C
    Source_location: 7 CHROMOSOME_II 1436716 1437073 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5472_external
      tm5472_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5472
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021789
    Transcript: Y51H7C.11.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 35473/35474-35829/35830 (356 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele