WormBase Tree Display for Variation: WBVar00600886

WBVar00600886 Name: Public_name: tm5515
    Other_name: CE05594:p.His68PhefsTer181
      F12F6.6.1:c.202_529del
    HGVSg: CHROMOSOME_IV:g.11565533_11565947del
  Sequence_details: SMap: S_parent: Sequence: F12F6
    Flanking_sequences: acgaacttggagagccgcctgcctgtggaa agacgaatttccatttaagcctccattttg
    Mapping_target: F12F6
    Source_location: 7 CHROMOSOME_IV 11565532 11565948 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5515_external
      tm5515_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5515
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004755
    Transcript: F12F6.6.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 21631/21632-22046/22047 (415 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele