WormBase Tree Display for Variation: WBVar00600928

WBVar00600928 Name: Public_name: tm5563
    Other_name: F57B9.6a.1:c.1058_*80delinsA
    HGVSg: CHROMOSOME_III:g.6931434_6931665delinsA
  Sequence_details: SMap: S_parent: Sequence: F57B9
    Flanking_sequences: atgatctcccatccaatcgtgagaactaca tatctgttttctcctccacccccaccgtcc
    Mapping_target: F57B9
    Source_location: 7 CHROMOSOME_III 6931433 6931666 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm5563_external
      tm5563_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5563
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002083
      WBGene00305460
    Transcript: F57B9.13
      F57B9.6a.1 VEP_consequence: stop_lost,3_prime_UTR_variant
        VEP_impact: HIGH
        HGVSc: F57B9.6a.1:c.1058_*80delinsA
        cDNA_position: 1061-1292
        CDS_position: 1058-?
        Protein_position: 353-?
        Exon_number: 6-7/7
      F57B9.6b.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 197-?
        CDS_position: 197-?
        Protein_position: 66-?
        Exon_number: 2/2
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 7269/7270-A-7501/7502 (232 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele