WormBase Tree Display for Variation: WBVar00600956

WBVar00600956 Name: Public_name: tm5592
    HGVSg: CHROMOSOME_III:g.10471202_10472077del
  Sequence_details: SMap: S_parent: Sequence: D2045
    Flanking_sequences: ttcttgcgaaattgacaaatcccttgattt attaaagtggagacaagacttaatcaagag
    Mapping_target: D2045
    Source_location: 7 CHROMOSOME_III 10471200 10472078 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: T
      Deletion
    PCR_product: tm5592_external
      tm5592_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5592
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000836
    Transcript: D2045.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-787
        CDS_position: ?-786
        Protein_position: ?-262
        Intron_number: 2/7
        Exon_number: 1-3/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 20185/20186-T-21062/21063 (877 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele