WormBase Tree Display for Variation: WBVar00601254
expand all nodes | collapse all nodes | view schema
WBVar00601254 | Evidence | Paper_evidence | WBPaper00040335 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | tr185 | |||||
Other_name | F53B6.2a.1:c.1052+1918G>A | ||||||
F53B6.2b.1:c.3G>A | |||||||
F53B6.2c.1:c.1046+1918G>A | |||||||
CE32429:p.Met1? | |||||||
HGVSg | CHROMOSOME_I:g.8937551C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F53B6 | |||
Flanking_sequences | gaagatctggatacaggttttggaattttggaacttgagcacaat | ctccccctactcctgattttatcagcaccattgggtgtcagtgct | |||||
Mapping_target | F53B6 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00040335 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (3) | |||||||
Affects | Gene | WBGene00009958 | |||||
Transcript | F53B6.2c.1 | VEP_consequence | intron_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | F53B6.2c.1:c.1046+1918G>A | ||||||
Intron_number | 8/17 | ||||||
F53B6.2a.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | F53B6.2a.1:c.1052+1918G>A | ||||||
Intron_number | 9/18 | ||||||
F53B6.2b.1 (12) | |||||||
Genetics | Interpolated_map_position | I | 3.3266 | ||||
Description | Phenotype | WBPhenotype:0001930 | Paper_evidence | WBPaper00040335 | |||
Curator_confirmed | WBPerson7190 | ||||||
Remark | Animals extend fewer muscle arms towards the dorsal nerve cord compared to the ventral nerve cord | Paper_evidence | WBPaper00040335 | ||||
Curator_confirmed | WBPerson7190 | ||||||
Reference | WBPaper00040335 | ||||||
Remark | Updated the flanking sequences to be on the correct ATG and Isoform reported in the paper. | ||||||
Method | Substitution_allele |