WormBase Tree Display for Variation: WBVar00603949

WBVar00603949 Evidence: Person_evidence: WBPerson105
  Name: Public_name: ju4
    Other_name: K12C11.4a.1:c.536C>T
      K12C11.4b.1:c.53C>T
      CE40262:p.Ser179Leu
      CE49530:p.Ser18Leu
    HGVSg: CHROMOSOME_I:g.1308063C>T
  Sequence_details: SMap: S_parent: Sequence: K12C11
    Flanking_sequences: cgcagatcaaaatcatcgatttcgggttgt aagagaaattgagccgggagcagtggtaaa
    Mapping_target: K12C11
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005350
    Laboratory: CZ
    Status: Live
  Affects: Gene: WBGene00003400
    Transcript: K12C11.4a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: K12C11.4a.1:c.536C>T
        HGVSp: CE40262:p.Ser179Leu
        cDNA_position: 549
        CDS_position: 536
        Protein_position: 179
        Exon_number: 4/15
        Codon_change: tCa/tTa
        Amino_acid_change: S/L
      K12C11.4b.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: K12C11.4b.1:c.53C>T
        HGVSp: CE49530:p.Ser18Leu
        cDNA_position: 53
        CDS_position: 53
        Protein_position: 18
        Exon_number: 1/11
        Codon_change: tCa/tTa
        Amino_acid_change: S/L
  Genetics: Interpolated_map_position: I -14.8516
  Description: Phenotype: WBPhenotype:0000520 Paper_evidence: WBPaper00033131
        Person_evidence: WBPerson105
        Curator_confirmed: WBPerson712
        Remark: Stronger than deletion gk219; unclear which is null or whether ju4 is gain of function. Person_evidence: WBPerson105
            Curator_confirmed: WBPerson712
          dapk-1 mutants appeared morphologically normal until midlarval development. Beginning in the L3 stage, dapk-1(ju4) mutants displayed striking and progressive defects in morphology of the epidermis and cuticle in specific body regions, especially in the nose, tail, vulva, and the dorsal midline in the region of the posterior pharyngeal bulb. Allelic series for morphological defects: ju4>ju557 >gk219 >ju469 Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Penetrance: Complete: Person_evidence: WBPerson105
              Curator_confirmed: WBPerson712
        Recessive: Person_evidence: WBPerson105
          Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Person_evidence: WBPerson105
              Curator_confirmed: WBPerson712
      WBPhenotype:0000701 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: The thickened cuticle of dapk-1 mutants accumulated proteins such as TSP-15, a component of the epithelial apical membrane, suggesting a breakdown of epithelial-cuticle integrity. Other epidermal compartments such as subapical adherens junctions appeared normal (data not shown). The areas of thickened cuticle and autofluorescent aggregates in dapk-1 mutants resemble the scars caused by needle or laser wounding of the C. elegans epidermis. Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
      WBPhenotype:0000730 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: C. elegans dapk-1 mutants have defects in apoptotic cell death (R.-H. Chen, J.-Y. Chen, and Y.-C.W., unpublished work) Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Rescued_by_transgene: WBTransgene00006574
          WBTransgene00006576
          WBTransgene00006559
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
      WBPhenotype:0000948 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: Cuticle in certain regions became up to 5-10 times thicker than the wild type, at the expense of underlying epidermis; this thickened cuticle appeared refractile under differential interference contrast (DIC) microscopy, and had aberrant ultrastructure with inclusions of electron-dense material (Fig. 1B). The areas of thickened cuticle and autofluorescent aggregates in dapk-1 mutants resemble the scars caused by needle or laser wounding of the C. elegans epidermis. Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
      WBPhenotype:0001013 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: Epidermal defects of mutants render them susceptible to infection and, thus, dependent on the epidermal innate immune pathway for adult viability. Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
      WBPhenotype:0001212 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: The areas of thickened cuticle and autofluorescent aggregates in dapk-1 mutants resemble the scars caused by needle or laser wounding of the C. elegans epidermis. The scar-like areas appear to be structurally weak, because they occasionally rupture in dapk-1 adults and in assays of cuticle fragility. Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
      WBPhenotype:0001678 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: By using transgenic markers, we found that regions of thickened cuticle accumulated collagens and other cuticle components (Fig. 1C). The thickened cuticle of dapk-1 mutants also accumulated proteins such as TSP-15, a component of the epithelial apical membrane, suggesting a breakdown of epithelial-cuticle integrity. Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
      WBPhenotype:0001800 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: We found that dapk-1 mutants constitutively up-regulated transgenic reporters for several epidermal AMP genes, compared with unwounded controls (Fig. 3 A and B, and Fig. S4A). However, dapk-1 mutants did not inappropriately induce other transcriptional responses to osmotic stress such as gpdh-1. Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000039 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: dapk-1 single mutants had normal lifespan. Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
      WBPhenotype:0001840 Paper_evidence: WBPaper00033131
        Curator_confirmed: WBPerson712
        Remark: Needle wounding of the wild type or of dapk-1 resulted in an 1.8-fold reduction of median lifespan (13 to 7 days; see Fig. 4B). dapk-1 mutants appear to have normal wound responses. Paper_evidence: WBPaper00033131
            Curator_confirmed: WBPerson712
        Temperature_sensitive: Heat_sensitive: Paper_evidence: WBPaper00033131
              Curator_confirmed: WBPerson712
  Reference: WBPaper00033131
  Method: Substitution_allele