WormBase Tree Display for Variation: WBVar00603967

WBVar00603967 Name: Public_name: tm5680
    Other_name: R03D7.8.1:c.263+17_401delinsT
    HGVSg: CHROMOSOME_II:g.10956072_10956510delinsA
  Sequence_details: SMap: S_parent: Sequence: R03D7
    Flanking_sequences: taacggtgcgaatacagaacgggctcatta aataatgtagacatacttgaagcttttgct
    Mapping_target: R03D7
    Source_location: 7 CHROMOSOME_II 10956071 10956511 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm5680_external
      tm5680_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5680
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010992
    Transcript: R03D7.8.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R03D7.8.1:c.263+17_401delinsT
        cDNA_position: ?-416
        CDS_position: ?-401
        Protein_position: ?-134
        Intron_number: 4/13
        Exon_number: 5/14
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 31658/31659-A-32097/32098 (439 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele