WormBase Tree Display for Variation: WBVar00603972

WBVar00603972 Name: Public_name: tm5685
    Other_name: Y73F8A.27.1:c.12_327delinsCCAGCCTTCCAGA
      CE25595:p.Leu5_Ter109delinsGlnProSerArg
    HGVSg: CHROMOSOME_IV:g.15472828_15473250delinsCCAGCCTTCCAGA
  Sequence_details: SMap: S_parent: Sequence: Y73F8A
    Flanking_sequences: caaattttcagctctcacaatgtcctccgt aacaagctcccggagccgctagaagaggaa
    Mapping_target: Y73F8A
    Source_location: 7 CHROMOSOME_IV 15472827 15473251 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CCAGCCTTCCAGA
      Deletion
    PCR_product: tm5685_external
      tm5685_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5685
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013532
    Transcript: Y73F8A.27.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 246490/246491-CCAGCCTTCCAGA-246913/246914 (423 bp deletion + 13 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele