WormBase Tree Display for Variation: WBVar00604002

WBVar00604002 Name: Public_name: tm5726
    Other_name: F56F3.1.1:c.7_364+10delinsCAGAAA
    HGVSg: CHROMOSOME_III:g.4474722_4475137delinsTTTCTG
  Sequence_details: SMap: S_parent: Sequence: F56F3
    Flanking_sequences: ataaagtttatgatcaaactcgtatttcca agtcatatttacactgaaaaatcgaatgtc
    Mapping_target: F56F3
    Source_location: 7 CHROMOSOME_III 4474721 4475138 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTTCTG
      Deletion
    PCR_product: tm5726_external
      tm5726_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5726
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004132
    Transcript: F56F3.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F56F3.1.1:c.7_364+10delinsCAGAAA
        cDNA_position: 14-?
        CDS_position: 7-?
        Protein_position: 3-?
        Intron_number: 2-3/11
        Exon_number: 2-3/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 22283/22284-TTTCTG-22699/22700 (416 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele