WormBase Tree Display for Variation: WBVar01429527

WBVar01429527 Name: Public_name: tm5835
    Other_name: T19A6.2b.1:c.254_363delinsCT
      CE32493:p.Lys144_Ter180delinsThr
      CE32494:p.Lys85_Ter121delinsThr
      T19A6.2a.1:c.431_540delinsCT
    HGVSg: CHROMOSOME_I:g.8395321_8395791delinsCT
  Sequence_details: SMap: S_parent: Sequence: T19A6
    Flanking_sequences: tgccgattagtctgcttcaagagaaggcaa aaaagcgccgaagatcgcgatgtgaagtac
    Mapping_target: T19A6
    Source_location: 7 CHROMOSOME_I 8395320 8395792 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CT
      Deletion
    PCR_product: tm5835_external
      tm5835_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5835
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003596
    Transcript: T19A6.2a.1 (11)
      T19A6.2b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 10308/10309-CT-10679/10780 (371 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele