WormBase Tree Display for Variation: WBVar01429573

WBVar01429573 Name: Public_name: tm5872
    Other_name: D2007.4.1:c.364-60_476delinsACAC
    HGVSg: CHROMOSOME_III:g.8145646_8145818delinsACAC
  Sequence_details: SMap: S_parent: Sequence: D2007
    Flanking_sequences: tcaaaaatccgtaactttctatgaaaagat gaagccaacacgtcaggataaactcgacga
    Mapping_target: D2007
    Source_location: 7 CHROMOSOME_III 8145645 8145819 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ACAC
      Deletion
    PCR_product: tm5872_external
      tm5872_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5872
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00017044
    Transcript: D2007.4.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: D2007.4.1:c.364-60_476delinsACAC
        cDNA_position: ?-479
        CDS_position: ?-476
        Protein_position: ?-159
        Intron_number: 3/4
        Exon_number: 4/5
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 908/909-ACAC-1081/1082 (173 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele