WormBase Tree Display for Variation: WBVar01429589

WBVar01429589 Name: Public_name: tm5921
    Other_name: F15D3.7.1:c.247_401del
      CE15854:p.Pro83GlufsTer6
    HGVSg: CHROMOSOME_I:g.11578940_11579152del
  Sequence_details: SMap: S_parent: Sequence: F15D3
    Flanking_sequences: cggcaaatgacaccctatgtgcagatggat gaacccggaaacccgtaaaatggtcggaaa
    Mapping_target: F15D3
    Source_location: 7 CHROMOSOME_I 11578939 11579153 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5921_external
      tm5921_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5921
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00008857
    Transcript: F15D3.7.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 38768/38769-38981/38982 (213 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele