WormBase Tree Display for Variation: WBVar01429590

WBVar01429590 Name: Public_name: tm5923
    Other_name: B0222.3.1:c.702_975delinsCTGTAGCATTACT
      CE30584:p.Trp235_Ter325delinsCysSerIleThr
    HGVSg: CHROMOSOME_V:g.9139734_9140056delinsAGTAATGCTACAG
  Sequence_details: SMap: S_parent: Sequence: B0222
    Flanking_sequences: aattgtagagaataattgagtaatgctacg actggaatttcgtcaaagtgaagaactgga
    Mapping_target: B0222
    Source_location: 7 CHROMOSOME_V 9139733 9140057 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AGTAATGCTACAG
      Deletion
    PCR_product: tm5923_external
      tm5923_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5923
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015055
    Transcript: B0222.3.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 7190/7191-AGTAATGCTACAG-7513/7514 (323 bp deletion + 13 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele