WormBase Tree Display for Variation: WBVar01429618
expand all nodes | collapse all nodes | view schema
| WBVar01429618 | Name | Public_name | tm5978 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | ZK686.2.1:c.88_279del | ||||||||
| CE34464:p.Met30_Ter93delextTer? | |||||||||
| HGVSg | CHROMOSOME_III:g.7765559_7765908del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | ZK686 | |||||
| Flanking_sequences | gaaagtagtggcgttttgaacccaggaact | ttcttgttcaattccgtctccgtttgctgg | |||||||
| Mapping_target | ZK686 | ||||||||
| Source_location | 7 | CHROMOSOME_III | 7765558 | 7765909 | Inferred_automatically | National_Bioresource_Project | |||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | tm5978_external | ||||||||
| tm5978_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | FX | ||||||||
| Author | Mitani S | ||||||||
| DB_info | Database | National_Bioresource_Project | seq | 5978 | |||||
| NBP_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00022792 | |||||||
| Transcript | ZK686.2.1 (11) | ||||||||
| Isolation | Mutagen | TMP/UV | |||||||
| Genetics | Map | III | |||||||
| Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0002259 | Paper_evidence | WBPaper00046432 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutants do not exhibit a reduction in PVD neuron terminal dendrites. | Paper_evidence | WBPaper00046432 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00046432 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| GO_term | GO:0044292 | PATO:0001997 | Paper_evidence | WBPaper00046432 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00046432 | ||||||||
| Remark | 1797/1798-2147/2148 (350 bp deletion) | ||||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
| Method | NBP_knockout_allele |
