WormBase Tree Display for Variation: WBVar01429620

WBVar01429620 Name: Public_name: tm5980
    Other_name: F25H2.10.1:c.236_500del
      CE09655:p.Leu79SerfsTer40
    HGVSg: CHROMOSOME_I:g.10568215_10568524del
  Sequence_details: SMap: S_parent: Sequence: F25H2
    Flanking_sequences: tcggaaagaatccatcccttgagaagttgt cggagcttccgaatctgctcttctcaacat
    Mapping_target: F25H2
    Source_location: 7 CHROMOSOME_I 10568214 10568525 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5980_external
      tm5980_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5980
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004408
    Transcript: F25H2.10.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 34307/34308-34617/34618 (310 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele