WormBase Tree Display for Variation: WBVar01429631

WBVar01429631 Name: Public_name: tm5950
    Other_name: CE09619:p.Thr39HisfsTer11
      F25B3.6.1:c.114_708del
    HGVSg: CHROMOSOME_V:g.9581822_9582514del
  Sequence_details: SMap: S_parent: Sequence: K09G1
    Flanking_sequences: cttatctttttcggatacacgttctggtga ctgagaggttttccaggttttggacctgcg
    Mapping_target: K09G1
    Source_location: 7 CHROMOSOME_V 9581821 9582515 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5950_external
      tm5950_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5950
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009103
    Transcript: F25B3.6.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [K09G1] 855/856-[K09G1] 1548/1549 (693 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele