WormBase Tree Display for Variation: WBVar01429652

WBVar01429652 Evidence: Paper_evidence: WBPaper00041321
  Name: Public_name: qx42
    Other_name: Y43H11AL.2b.1:c.120-2A>T
      Y43H11AL.2a.1:c.384-2A>T
    HGVSg: CHROMOSOME_II:g.235997T>A
  Sequence_details: SMap: S_parent: Sequence: Y43H11AL
    Flanking_sequences: tgttggaacgcgctgatgacgtggtaggtc ggaaatacgattttgtagtttgtagagtag
    Mapping_target: Y43H11AL
    Type_of_mutation: Substitution: t a Curator_confirmed: WBPerson4055
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: XW
    Status: Live
  Affects: Gene: WBGene00021546
    Transcript: Y43H11AL.2b.1 VEP_consequence: splice_acceptor_variant
        VEP_impact: HIGH
        HGVSc: Y43H11AL.2b.1:c.120-2A>T
        Intron_number: 1/3
      Y43H11AL.2a.1 VEP_consequence: splice_acceptor_variant
        VEP_impact: HIGH
        HGVSc: Y43H11AL.2a.1:c.384-2A>T
        Intron_number: 4/7
    Interactor: WBInteraction000518670
      WBInteraction000518671
      WBInteraction000518672
      WBInteraction000518673
      WBInteraction000518674
  Genetics: Interpolated_map_position: II -15.739
  Description: Phenotype: WBPhenotype:0000050 Paper_evidence: WBPaper00041321
        Curator_confirmed: WBPerson3997
        Penetrance: Incomplete: 50 Paper_evidence: WBPaper00041321
              Curator_confirmed: WBPerson3997
        Phenotype_assay: Genotype: gcn-2(ok871) Paper_evidence: WBPaper00041321
              Curator_confirmed: WBPerson3997
    Phenotype_not_observed: WBPhenotype:0002394 Paper_evidence: WBPaper00048406
        Curator_confirmed: WBPerson17560
        Remark: Figure 3, unsealed phagosomes can be labeled by PLC delta 1-PH and the membrane impermeable dye FM4-64. Loss of mtm-1, piki-1, lst-4, dyn-1 or ocrl-1 shows phagosome sealing defective Paper_evidence: WBPaper00048406
            Curator_confirmed: WBPerson17560
  Disease_info: Models_disease: DOID:3211
    Models_disease_in_annotation: WBDOannot00000101
  Reference: WBPaper00041321
    WBPaper00048406
  Remark: Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues.
    [200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand Curator_confirmed: WBPerson4055
  Method: Substitution_allele