WormBase Tree Display for Variation: WBVar01429656
expand all nodes | collapse all nodes | view schema
WBVar01429656 | Evidence | Paper_evidence | WBPaper00041213 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n4547 | |||||
Other_name | Y43H11AL.3a.2:c.-12-3342_-12-2333del | ||||||
HGVSg | CHROMOSOME_II:g.257527_258536del | ||||||
Sequence_details | SMap | S_parent | Sequence | B0432 | |||
Flanking_sequences | tttaaaaactatgtgaagtcacacctgtct | atcattttgaaaatccgacctttttgcgaa | |||||
Mapping_target | B0432 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects | Gene | WBGene00004166 | |||||
WBGene00000296 | |||||||
Transcript | Y43H11AL.3a.2 | VEP_consequence | intron_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | Y43H11AL.3a.2:c.-12-3342_-12-2333del | ||||||
Intron_number | 1/28 | ||||||
B0432.5c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
Intron_number | 2/8 | ||||||
Exon_number | 1-2/9 | ||||||
B0432.5a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
Intron_number | 1/8 | ||||||
Exon_number | 1/9 | ||||||
B0432.5b.1 | VEP_consequence | 5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | ||||||
cDNA_position | ?-640 | ||||||
Exon_number | 1/9 | ||||||
Genetics | Interpolated_map_position | II | -15.6718 | ||||
Description | Phenotype | WBPhenotype:0000641 | Paper_evidence | WBPaper00041213 | |||
Curator_confirmed | WBPerson461 | ||||||
Remark | Figure 3. The locomotion rates of cat-2 mutants were more variable than those of wild-type animals; Figure 4. cat-2 mutants achieve greater peak acceleration, resulting in large fluctuations in the speed within tracks. | Paper_evidence | WBPaper00041213 | ||||
Curator_confirmed | WBPerson461 | ||||||
Disease_info | Models_disease | DOID:14330 | |||||
Models_disease_in_annotation | WBDOannot00000970 | ||||||
Reference (3) | |||||||
Method | Deletion_allele |