WormBase Tree Display for Variation: WBVar01473748

WBVar01473748 Name: Public_name: tm6013
    HGVSg: CHROMOSOME_I:g.182568_182935del
  Sequence_details: SMap: S_parent: Sequence: F56C11
    Flanking_sequences: agcgaaccgagctcatccttgtctactgga aaaaattaactaaaaacaagaaatgcaagt
    Mapping_target: F56C11
    Source_location: 7 CHROMOSOME_I 182567 182936 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6013_external
      tm6013_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6013
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018955
    Transcript: F56C11.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-150
        CDS_position: ?-149
        Protein_position: ?-50
        Intron_number: 2/5
        Exon_number: 1-3/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 36034/36035-36402/36403 (368 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele