WormBase Tree Display for Variation: WBVar01473758

WBVar01473758 Name: Public_name: tm6030
    HGVSg: CHROMOSOME_IV:g.7785216_7785593delinsTTAC
  Sequence_details: SMap: S_parent: Sequence: C33H5
    Flanking_sequences: gcaatatttcaaaagaaaacttacaatttc agagaaaatgtgttcaatggagtaaacaac
    Mapping_target: C33H5
    Source_location: 7 CHROMOSOME_IV 7785215 7785594 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTAC
      Deletion
    PCR_product: tm6030_external
      tm6030_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6030
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00044326
    Transcript: C33H5.10.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-299
        CDS_position: ?-297
        Protein_position: ?-99
        Intron_number: 2/8
        Exon_number: 1-3/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 11595/11596-TTAC-11973/11974 (378 bp deletion + 4 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele