WormBase Tree Display for Variation: WBVar01473806

WBVar01473806 Name: Public_name: tm6071
    Other_name: F11C7.4.1:c.584-42_823-10delinsTA
    HGVSg: CHROMOSOME_X:g.17411780_17412165delinsTA
  Sequence_details: SMap: S_parent: Sequence: F11C7
    Flanking_sequences: caactctttacagtcggcaccctgcaatta tgtttttataaaataatttattcgaatgta
    Mapping_target: F11C7
    Source_location: 7 CHROMOSOME_X 17411779 17412166 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TA
      Deletion
    PCR_product: tm6071_external
      tm6071_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6071
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000792
    Transcript: F11C7.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F11C7.4.1:c.584-42_823-10delinsTA
        Intron_number: 5-7/31
        Exon_number: 6-7/32
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 19230/19231-TA-19616/19617 (386 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele