WormBase Tree Display for Variation: WBVar01473853

WBVar01473853 Name: Public_name: tm6117
    Other_name: C27F2.8.1:c.414_754-107del
    HGVSg: CHROMOSOME_III:g.4996954_4997505del
  Sequence_details: SMap: S_parent: Sequence: C27F2
    Flanking_sequences: gattttcgaaaattggtcatttgaaagttt ttgcgtttctgcgcggtaccgacagaactg
    Mapping_target: C27F2
    Source_location: 7 CHROMOSOME_III 4996953 4997506 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6117_external
      tm6117_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6117
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016170
    Transcript: C27F2.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C27F2.8.1:c.414_754-107del
        cDNA_position: 442-?
        CDS_position: 414-?
        Protein_position: 138-?
        Intron_number: 4-5/16
        Exon_number: 4-5/17
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 39570/39571-40122/40123 (552 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele