WormBase Tree Display for Variation: WBVar01474058

WBVar01474058 Name: Public_name: tm6174
    Other_name: Y71G12B.8.1:c.510_558+336del
    HGVSg: CHROMOSOME_I:g.1768451_1768835del
  Sequence_details: SMap: S_parent: Sequence: Y71G12B
    Flanking_sequences: gaaggcgtgctccggcgctggatattcgga atatattcttccgaaaaaaaaattttcaca
    Mapping_target: Y71G12B
    Source_location: 7 CHROMOSOME_I 1768450 1768836 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6174_external
      tm6174_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6174
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022148
    Transcript: Y71G12B.8.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y71G12B.8.1:c.510_558+336del
        cDNA_position: 565-?
        CDS_position: 510-?
        Protein_position: 170-?
        Intron_number: 2/7
        Exon_number: 2/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 128023/128024-128408/128409 (385 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele