WormBase Tree Display for Variation: WBVar01474081

WBVar01474081 Name: Public_name: tm6198
    Other_name: F57B10.3a.1:c.652_858del
      CE11302:p.Asn218_Ter286delextTer?
      F57B10.3b.1:c.598_804del
      CE33113:p.Asn200_Ter268delextTer?
    HGVSg: CHROMOSOME_I:g.6571030_6571507del
  Sequence_details: SMap: S_parent: Sequence: F57B10
    Flanking_sequences: gttggccgctactatgctatggatcgcgat cgtatgcgtgagatttctgcagcaatggga
    Mapping_target: F57B10
    Source_location: 7 CHROMOSOME_I 6571029 6571508 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6198_external
      tm6198_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6198
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019001
    Transcript: F57B10.3b.1 (11)
      F57B10.3a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 22645/22646-23123/23124 (478 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele