WormBase Tree Display for Variation: WBVar01474088
expand all nodes | collapse all nodes | view schema
WBVar01474088 | Name | Public_name | tm6207 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F32E10.6.1:c.417_804del | |||||||
CE04479:p.Gly140ArgfsTer13 | ||||||||
HGVSg | CHROMOSOME_IV:g.7579070_7579538del | |||||||
Sequence_details | SMap | S_parent | Sequence | F32E10 | ||||
Flanking_sequences | ttcgtcttcttcctcaggagtctcagcacgcttcga | cgccacatgaccaaaaacagtggcttgttc | ||||||
Mapping_target | F32E10 | |||||||
Source_location | 7 | CHROMOSOME_IV | 7579069 | 7579539 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm6207_external | |||||||
tm6207_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6207 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00017993 | ||||||
Transcript | F32E10.6.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National BioResource Project of Japan. However, comment to the NBP from Dr. M. Zetka: Homozygous animals segregated. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00065293 | |||||||
Remark | 20650/20651-21119/21120 (469 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |