WormBase Tree Display for Variation: WBVar01474088

WBVar01474088 Name: Public_name: tm6207
    Other_name: F32E10.6.1:c.417_804del
      CE04479:p.Gly140ArgfsTer13
    HGVSg: CHROMOSOME_IV:g.7579070_7579538del
  Sequence_details: SMap: S_parent: Sequence: F32E10
    Flanking_sequences: ttcgtcttcttcctcaggagtctcagcacgcttcga cgccacatgaccaaaaacagtggcttgttc
    Mapping_target: F32E10
    Source_location: 7 CHROMOSOME_IV 7579069 7579539 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6207_external
      tm6207_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6207
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00017993
    Transcript: F32E10.6.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. However, comment to the NBP from Dr. M. Zetka: Homozygous animals segregated. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00065293
  Remark: 20650/20651-21119/21120 (469 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele