WormBase Tree Display for Variation: WBVar01474097

WBVar01474097 Name: Public_name: tm6221
    Other_name (28)
    HGVSg: CHROMOSOME_II:g.166973_167426del
  Sequence_details: SMap: S_parent: Sequence: T01D1
    Flanking_sequences: ccaaatcaaaagtttcagctcggcggtgga tatgaagtgtgtgttctcgtatccctctcg
    Mapping_target: T01D1
    Source_location: 7 CHROMOSOME_II 166972 167427 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6221_external
      tm6221_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6221
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001340
    Transcript (28)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 4304/4305-4758/4759 (454 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele