WormBase Tree Display for Variation: WBVar01474144

WBVar01474144 Name: Public_name: tm6262
    Other_name (16)
    HGVSg: CHROMOSOME_IV:g.3117716_3118188del
  Sequence_details: SMap: S_parent: Sequence: Y67D8C
    Flanking_sequences: cgaattgaataataacgacttgagagatca tggaattgcaagaatttagcgatcgaatcg
    Mapping_target: Y67D8C
    Source_location: 7 CHROMOSOME_IV 3117715 3118189 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6262_external
      tm6262_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6262
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00305860
      WBGene00305861
      WBGene00003153
      WBGene00305862
    Transcript (14)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 85014/85015-85487/85488 (473 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele