WormBase Tree Display for Variation: WBVar01474161

WBVar01474161 Name: Public_name: tm6298
    Other_name: ZC518.2.1:c.753_1042del
      CE32286:p.Ile252SerfsTer10
    HGVSg: CHROMOSOME_IV:g.12359268_12359862del
  Sequence_details: SMap: S_parent: Sequence: ZC518
    Flanking_sequences: tacagagattgcatttccagtgtcgatgat atatcattgcgatacccgcccatttgttgc
    Mapping_target: ZC518
    Source_location: 7 CHROMOSOME_IV 12359267 12359863 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6298_external
      tm6298_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6298
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004756
    Transcript: ZC518.2.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 11448/11449-12043/12044 (595 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele