WormBase Tree Display for Variation: WBVar01474163

WBVar01474163 Name: Public_name: tm6282
    Other_name: CE00835:p.Gln165LeufsTer21
      B0361.6.1:c.494_792del
    HGVSg: CHROMOSOME_III:g.7276196_7276599del
  Sequence_details: SMap: S_parent: Sequence: B0361
    Flanking_sequences: tccagtcataagtcgcacagaatatcccca gaattggaaatagatcttttcgaaggtatt
    Mapping_target: B0361
    Source_location: 7 CHROMOSOME_III 7276195 7276600 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6282_external
      tm6282_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6282
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015160
    Transcript: B0361.6.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 11674/11675-12078/12079 (404 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele