WormBase Tree Display for Variation: WBVar01474187

WBVar01474187 Name: Public_name: tm6290
    Other_name: CE01784:p.Asn23GlnfsTer9
      C14F5.5.1:c.66_195del
    HGVSg: CHROMOSOME_X:g.7961297_7961647del
  Sequence_details: SMap: S_parent: Sequence: C14F5
    Flanking_sequences: tttcagcaatacttctgcgtcatttcttgt cctctcttgaaagacaactcatcaggtgat
    Mapping_target: C14F5
    Source_location: 7 CHROMOSOME_X 7961296 7961648 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6290_external
      tm6290_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6290
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004774
    Transcript: C14F5.5.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 31703/31704-32054/32055 (351 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele