WormBase Tree Display for Variation: WBVar01474221

WBVar01474221 Name: Public_name: tm6331
    Other_name: C44B12.2a.1:c.89_136+490del
    HGVSg: CHROMOSOME_IV:g.1107586_1108123del
  Sequence_details: SMap: S_parent: Sequence: C44B12
    Flanking_sequences: ttcagaaaaagaagatcgctgatgatgagc attcgaaaccccttccgactgataatgatg
    Mapping_target: C44B12
    Source_location: 7 CHROMOSOME_IV 1107585 1108124 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6331_external
      tm6331_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6331
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003893
    Transcript: C44B12.2a.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C44B12.2a.1:c.89_136+490del
        cDNA_position: 142-?
        CDS_position: 89-?
        Protein_position: 30-?
        Intron_number: 3/7
        Exon_number: 3/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 7169/7170-7707/7708 (538 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele