WormBase Tree Display for Variation: WBVar01474241
expand all nodes | collapse all nodes | view schema
WBVar01474241 | Evidence | Paper_evidence | WBPaper00042171 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | et17 | |||||||
Other_name | ZC376.7c.2:c.11G>A | ||||||||
ZC376.7b.2:c.11G>A | |||||||||
CE32033:p.Arg4His | |||||||||
ZC376.7b.1:c.11G>A | |||||||||
ZC376.7a.1:c.11G>A | |||||||||
ZC376.7c.1:c.11G>A | |||||||||
ZC376.7a.2:c.11G>A | |||||||||
CE15205:p.Arg4His | |||||||||
CE38576:p.Arg4His | |||||||||
HGVSg | CHROMOSOME_V:g.14194493G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC376 | |||||
Flanking_sequences | tctgaaacagtaccatcaaaatgttttccc | tgtgggacgtctcacaacttttggtgccc | |||||||
Mapping_target | ZC376 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031163 | ||||||||
WBStrain00052572 | |||||||||
Laboratory | QC | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00013878 | |||||||
Transcript | ZC376.7c.1 (12) | ||||||||
ZC376.7a.2 (12) | |||||||||
ZC376.7b.2 (12) | |||||||||
ZC376.7a.1 (12) | |||||||||
ZC376.7c.2 (12) | |||||||||
ZC376.7b.1 (12) | |||||||||
Interactor | WBInteraction000519944 | ||||||||
WBInteraction000537291 | |||||||||
Genetics | Interpolated_map_position | V | 6.19599 | ||||||
Description | Phenotype | WBPhenotype:0000030 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson488 | ||||||||
Remark | "The statin-resistant mutants also improved the growth of a lethal HMG-CoA reductase null mutant but only when small doses of mevalonate were also provided, suggesting that some residual HMG-CoA reductase activity persists in statin-treated worms (Fig. S1A)." | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Affected_by | Molecule | WBMol:00004697 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson488 | ||||||||
Phenotype_assay | Genotype | hmgr-1(tm4368) | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson488 | ||||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The endogenous UPRmt targets hsp-6, hsp-60 and timm-23 were significantly induced in the atfs-1(et17) and atfs-1(et18) strains, relative to N2 (Fig. 7e), demonstrating constitutive activation of the UPRmt in these animals." | Paper_evidence | WBPaper00045028 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00042171 | |||||||
WBPaper00045028 | |||||||||
Curator_confirmed | WBPerson488 | ||||||||
WBPerson2987 | |||||||||
Remark | Figure S3A | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"To determine whether constitutive activation of the UPRmt is sufficient to extend lifespan in the absence of ETC inhibition, we measured the lifespans of strains carrying either the atfs-1(et17) or atfs-1(et18) alleles. In both cases, lifespan was significantly reduced at 20C, rather than extended (Fig. 7a,b). Similar results were obtained at 25C, although the reduction in lifespan was attenuated at the higher temperature (Fig. 7c,d)." | Paper_evidence | WBPaper00045028 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
WBPaper00045028 | |||||||||
Curator_confirmed | WBPerson488 | ||||||||
WBPerson2987 | |||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "the UPRmt reporters hsp-60::GFP and hsp-6::GFP (but not the UPRer reporter hsp-4::GFP) are constitutively expressed in the mutants (Fig. 2C)" | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | hsp-60::GFP | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001502 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Remark | "The isolated mutants are resistant to two statins (fluvastatin and rosuvastatin) and to ibandronate (which inhibits farnesyl diphosphate synthase, i.e., several steps downstream of HMG-CoA reductase) (Fig. 1 B-D)." | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Affected_by | Molecule | WBMol:00007789 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson488 | ||||||||
WBPhenotype:0001719 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Remark | "the UPRmt reporters hsp-60::GFP and hsp-6::GFP (but not the UPRer reporter hsp-4::GFP) are constitutively expressed in the mutants (Fig. 2C)" | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00048404 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "These gain-of-function mutations in the atfs-1 gene (leading to constitutive mtUPR activation) were sufficient to protect against a severe hypoxic injury, which led to the death of wild-type worms (Figure 2F), indicating that mtUPR activation by ATFS-1 is sufficient to protect against hypoxic injury." | Paper_evidence | WBPaper00048404 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0001666 | PATO:0000460 | Paper_evidence | WBPaper00048404 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 20 hours of hypoxia and assayed for survival | Paper_evidence | WBPaper00048404 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002379 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Phenotype_not_observed | WBPhenotype:0000061 | Paper_evidence | WBPaper00050972 | ||||||
Curator_confirmed | WBPerson2563 | ||||||||
Remark | tested in monoxenic and axenic medium | Paper_evidence | WBPaper00050972 | ||||||
Curator_confirmed | WBPerson2563 | ||||||||
WBPhenotype:0001502 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Finally, there is no evidence that the mutant alleles et15-et18 confer general resistance against xenobiotics because they exhibited no resistance to several tested growth inhibitors (Fig. S1 B-D)." | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003029 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00003638 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00003033 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00042171 | ||||||||
WBPaper00045028 | |||||||||
WBPaper00048404 | |||||||||
WBPaper00050972 | |||||||||
WBPaper00062005 | |||||||||
Method | Substitution_allele |