WormBase Tree Display for Variation: WBVar01474242
expand all nodes | collapse all nodes | view schema
WBVar01474242 | Evidence | Paper_evidence | WBPaper00042171 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | et15 | |||||||
Other_name | ZC376.7b.1:c.17G>A | ||||||||
ZC376.7c.1:c.17G>A | |||||||||
ZC376.7c.2:c.17G>A | |||||||||
ZC376.7a.2:c.17G>A | |||||||||
ZC376.7a.1:c.17G>A | |||||||||
CE15205:p.Gly6Glu | |||||||||
ZC376.7b.2:c.17G>A | |||||||||
CE38576:p.Gly6Glu | |||||||||
CE32033:p.Gly6Glu | |||||||||
HGVSg | CHROMOSOME_V:g.14194499G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC376 | |||||
Flanking_sequences | acagtaccatcaaaatgttttcccgtgtgg | acgtctcacaacttttggtgcccaggctgt | |||||||
Mapping_target | ZC376 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00031161 | ||||||||
WBStrain00052571 | |||||||||
Laboratory | QC | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00013878 | |||||||
Transcript | ZC376.7c.1 (12) | ||||||||
ZC376.7a.2 (12) | |||||||||
ZC376.7b.2 (12) | |||||||||
ZC376.7a.1 (12) | |||||||||
ZC376.7c.2 (12) | |||||||||
ZC376.7b.1 (12) | |||||||||
Interactor | WBInteraction000519944 | ||||||||
WBInteraction000519945 | |||||||||
WBInteraction000536788 | |||||||||
WBInteraction000537442 | |||||||||
WBInteraction000537446 | |||||||||
Genetics | Interpolated_map_position | V | 6.196 | ||||||
Description | Phenotype | WBPhenotype:0000030 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson488 | ||||||||
Remark | "The statin-resistant mutants also improved the growth of a lethal HMG-CoA reductase null mutant but only when small doses of mevalonate were also provided, suggesting that some residual HMG-CoA reductase activity persists in statin-treated worms (Fig. S1A)." | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Affected_by | Molecule | WBMol:00004697 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson488 | ||||||||
Phenotype_assay | Genotype | hmgr-1(tm4368) | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson488 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure S3B | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
WBPerson2987 | |||||||||
Remark | Figure S3A | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00042171 | |||||||
WBPaper00046863 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "the UPRmt reporters hsp-60::GFP and hsp-6::GFP (but not the UPRer reporter hsp-4::GFP) are constitutively expressed in the mutants (Fig. 2C)" | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
atfs-1(et15) resulted in increased expression of the hsp-60::GFP transgene (Figure 5B,5C) | Paper_evidence | WBPaper00046863 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00046863 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | hsp-6::GFP | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
hsp-60::GFP | Paper_evidence | WBPaper00042171 | |||||||
WBPaper00046863 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001382 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The atfs-1(et15) and atfs-1(et18) mutants were also partially resistant to the prenylation inhibitory effects of statins (Fig. 4 D and E)." | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003950 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | protein prenylation reporter (pGLO-1P::GFP-CAAX) | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001502 | Paper_evidence | WBPaper00042171 | |||||||
WBPaper00046863 | |||||||||
Curator_confirmed | WBPerson488 | ||||||||
WBPerson2987 | |||||||||
Remark | "The isolated mutants are resistant to two statins (fluvastatin and rosuvastatin) and to ibandronate (which inhibits farnesyl diphosphate synthase, i.e., several steps downstream of HMG-CoA reductase) (Fig. 1 B-D)." | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
"This is consistent with the improved protection of the atfs-1(et15) gof mutant against ethidium bromide (EtBr) (Fig. S4 A-C), which impairs replication and transcription of the mitochondrial genome in cultured cells thus reducing the synthesis of mitochondrially encoded polypeptides (16-19), and the improved respiration of this mutant when challenged with statin (see below)." | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"We found that the atfs-1(et15) gof mutant is resistant to gliotoxin, whereas the atfs-1(gk3094) null mutant is hypersensitive (Fig. 4 A-C)." | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Ten of these mutants were characterized in some detail. All were growth-inhibited by 0.5 mM fluvastatin, to which the atfs-1(et15) allele is resistant, and all harbored mutations within the coding region of atfs-1 (Figure 5, D and E)." | Paper_evidence | WBPaper00046863 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Affected_by | Molecule | WBMol:00007789 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson488 | ||||||||
WBMol:00005361 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00004311 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00003950 | Paper_evidence | WBPaper00046863 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001719 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Remark | "the UPRmt reporters hsp-60::GFP and hsp-6::GFP (but not the UPRer reporter hsp-4::GFP) are constitutively expressed in the mutants (Fig. 2C)" | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00048404 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "These gain-of-function mutations in the atfs-1 gene (leading to constitutive mtUPR activation) were sufficient to protect against a severe hypoxic injury, which led to the death of wild-type worms (Figure 2F), indicating that mtUPR activation by ATFS-1 is sufficient to protect against hypoxic injury." | Paper_evidence | WBPaper00048404 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0001666 | PATO:0000460 | Paper_evidence | WBPaper00048404 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to 20 hours of hypoxia and assayed for survival | Paper_evidence | WBPaper00048404 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002141 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Indeed, fluvastatin treatment does cause reduced respiration in C. elegans, and the atfs-1(et15) mutant respires normally even in the presence of fluvastatin (Fig. S7A)." | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003950 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002379 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Dominant | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson488 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson488 | ||||||||
Phenotype_not_observed | WBPhenotype:0001236 | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "the UPRmt reporters hsp-60::GFP and hsp-6::GFP (but not the UPRer reporter hsp-4::GFP) are constitutively expressed in the mutants (Fig. 2C)" | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | hsp-4::GFP | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001502 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Finally, there is no evidence that the mutant alleles et15-et18 confer general resistance against xenobiotics because they exhibited no resistance to several tested growth inhibitors (Fig. S1 B-D)." | Paper_evidence | WBPaper00042171 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"the atfs-1(et15) mutant is not resistant to rotenone, antimycin A, or sodium azide, which are inhibitors of the mitochondrial respiratory chain (25, 26) (Fig. S7 B-D)" | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00003029 | Paper_evidence | WBPaper00042171 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00003638 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00003033 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00004310 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00005355 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBMol:00001525 | Paper_evidence | WBPaper00042171 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00042171 | ||||||||
WBPaper00046863 | |||||||||
WBPaper00048404 | |||||||||
WBPaper00062005 | |||||||||
Method | Substitution_allele |