WormBase Tree Display for Variation: WBVar01474258
expand all nodes | collapse all nodes | view schema
WBVar01474258 | Evidence | Paper_evidence | WBPaper00042204 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ww5 | |||||||
Other_name | CE30404:p.Gly419Glu | ||||||||
ZK1058.1.1:c.1256G>A | |||||||||
HGVSg | CHROMOSOME_III:g.3905647C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1058 | |||||
Flanking_sequences | gaatctgcaatgttgccgatccttggggag | atcatatatgatggaatcacttactgacga | |||||||
Mapping_target | ZK1058 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (3) | |||||||||
Affects | Gene | WBGene00014202 | |||||||
Transcript | ZK1058.1.1 (12) | ||||||||
Interactor | WBInteraction000520020 | ||||||||
Genetics | Interpolated_map_position | III | -4.23461 | ||||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To verify that the mutations truly affect the expression of acdh-1, we examined endogenous messenger RNA (mRNA) levels in four mutants. When grown on Comamonas DA1877, all mutants showed an increase in acdh-1 mRNA levels relative to wild-type animals, which confirms the results obtained with the dietary sensor (Figure 1D, orange bars). We found similar changes in expression of two other diet-responsive genes, acdh-2 and ech-6, in these mutants (Figure 1D and data not shown). When fed E_coli OP50, the expression of these genes was similar in wild-type and mutant animals (Figure 1D, purple bars), demonstrating that the mutations do not cause a general increase in their expression. In three of the four mutants, the expression of acdh-1 was lower on Comamonas DA1877 than on E_coli OP50, indicating that they are still somewhat able to respond to dietary cues (Figure 1D, compare orange and purple bars). The dietary response was completely impaired only in the mmcm-1(ww5) mutant (Figure 1D)." | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Worms fed on a Comamonas DA1877 diet | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00042204 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We performed a forward genetic screen to identify genes that, when mutated, cause activation of the acdh-1 promoter on a Comamonas DA1877 diet. We mutagenized the dietary sensor strain, screened ~10,000 genomes, and isolated 45 fertile F2 mutants that produced GFP-positive offspring (Figure 1A). These mutants varied in both level and pattern of GFP expression. For example, some mutants displayed relatively broad expression in the intestine, hypodermis, and muscle, whereas others express GFP only in the intestine (Figure 1B and Table S1)." | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Worms fed on a Comamonas DA1877 diet | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | Pacdh-1::GFP | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00042204 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | This mutation caused ectopic expression of the Pacdh-1::GFP transgene in the pharynx (Table S1) | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00042204 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Worms fed on a Comamonas DA1877 diet | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | Pacdh-1::GFP | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000147 | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The acdh-1 promoter not only responds to different bacterial diets but is also repressed upon starvation (MacNeil et_al, 2013; Van Gilst et_al, 2005). We tested the response to starvation in our mutants. When starved for 24 hr, mccc-1(ww4) mutant animals retain GFP expression, which indicates that the starvation response is impaired in these mutants as well. In contrast, in mmcm-1, pccb-1, and gcst-1 mutants, GFP expression was reduced, indicating that the response to starvation is retained (Figure 1E). mmcm-1(ww5) mutants are completely impaired in the dietary response (Figure 1D) but retain a starvation response, confirming that these two responses are distinct (MacNeil et_al, 2013)." | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | Pacdh-1::GFP | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00042204 | ||||||||
Method | Substitution_allele |