WormBase Tree Display for Variation: WBVar01474260
expand all nodes | collapse all nodes | view schema
WBVar01474260 | Evidence | Paper_evidence | WBPaper00042204 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ww20 | |||||||
Other_name | F32B6.2.1:c.845C>T | ||||||||
CE35517:p.Ala282Val | |||||||||
HGVSg | CHROMOSOME_IV:g.9885559C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F32B6 | |||||
Flanking_sequences | tcggagaatcagctgttcgtgctgcggcgg | tgtgggatatgttggagcaggtaccgtcga | |||||||
Mapping_target | F32B6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | VL | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00009319 | |||||||
Transcript | F32B6.2.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | 4.43713 | ||||||
Description | Phenotype | WBPhenotype:0001236 | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We performed a forward genetic screen to identify genes that, when mutated, cause activation of the acdh-1 promoter on a Comamonas DA1877 diet. We mutagenized the dietary sensor strain, screened ~10,000 genomes, and isolated 45 fertile F2 mutants that produced GFP-positive offspring (Figure 1A). These mutants varied in both level and pattern of GFP expression. For example, some mutants displayed relatively broad expression in the intestine, hypodermis, and muscle, whereas others express GFP only in the intestine (Figure 1B and Table S1)." | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Worms fed on a Comamonas DA1877 diet | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | Pacdh-1::GFP | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00042204 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | This mutation caused ectopic expression of the Pacdh-1::GFP transgene in muscle and the pharynx (Table S1) | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00042204 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003675 | PATO:0000460 | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Worms fed on a Comamonas DA1877 diet | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | Pacdh-1::GFP | Paper_evidence | WBPaper00042204 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00042204 | ||||||||
Method | Substitution_allele |