WormBase Tree Display for Variation: WBVar01474394

WBVar01474394 Name: Public_name: tm6383
    Other_name (15)
    HGVSg: CHROMOSOME_X:g.11833792_11834979del
  Sequence_details: SMap: S_parent: Sequence: F54F7
    Flanking_sequences: caaaaactaactcggaagtaccgtcttagc cgggtagaaaaacatcaaatgatgagtatt
    Mapping_target: F54F7
    Source_location: 7 CHROMOSOME_X 11833791 11834980 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6383_external
      tm6383_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6383
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00044079
    Transcript: C34E11.3f.1 (11)
      C34E11.3d.1 (11)
      C34E11.3e.1 (11)
      C34E11.3b.1 (11)
      C34E11.3c.2 (11)
      C34E11.3g.1 (11)
      C34E11.3a.1 (11)
      C34E11.3c.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: [F54F7] 1137/1138-[F54F7] 2325/2326 (1188 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele