WormBase Tree Display for Variation: WBVar01474405

WBVar01474405 Name: Public_name: tm6394
    HGVSg: CHROMOSOME_III:g.7084178_7085045del
  Sequence_details: SMap: S_parent: Sequence: ZK418
    Flanking_sequences: taatatgacgaccgccacgccctgaagttc caaaaactcgcgtagtggaaaatacgcaat
    Mapping_target: ZK418
    Source_location: 7 CHROMOSOME_III 7084177 7085046 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6394_external
      tm6394_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6394
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022737
    Transcript: ZK418.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2-6/7
        Exon_number: 1-6/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 14926/14927-15794/15795 (868 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele