WormBase Tree Display for Variation: WBVar01474416

WBVar01474416 Name: Public_name: tm6413
    Other_name: F28B3.8.2:c.713_1057del
      F28B3.8.1:c.713_1057del
      CE30523:p.Arg238_Ter353delinsGln
    HGVSg: CHROMOSOME_I:g.4924518_4925094del
  Sequence_details: SMap: S_parent: Sequence: F28B3
    Flanking_sequences: cagcaagcatcaagcatacaccggcagctt gttgatcactgctgctcgtcgattcacaaa
    Mapping_target: F28B3
    Source_location: 7 CHROMOSOME_I 4924517 4925095 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm6413_external
      tm6413_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 6413
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002075
    Transcript: F28B3.8.2 (11)
      F28B3.8.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal or sterile by the National BioResource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 3429/3430-4006/4007 (577 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele