WormBase Tree Display for Variation: WBVar01474448
expand all nodes | collapse all nodes | view schema
WBVar01474448 | Name | Public_name | tm6437 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F52C12.4b.1:c.433-148_604delinsAAGAA | |||||||
F52C12.4f.1:c.433-148_604delinsAAGAA | ||||||||
F52C12.4g.1:c.433-148_604delinsAAGAA | ||||||||
F52C12.4d.1:c.433-148_604delinsAAGAA | ||||||||
F52C12.4c.1:c.433-148_604delinsAAGAA | ||||||||
F52C12.4h.1:c.433-148_604delinsAAGAA | ||||||||
F52C12.4a.1:c.433-148_604delinsAAGAA | ||||||||
F52C12.4e.1:c.433-148_604delinsAAGAA | ||||||||
HGVSg | CHROMOSOME_IV:g.1927503_1927822delinsAAGAA | |||||||
Sequence_details | SMap | S_parent | Sequence | F52C12 | ||||
Flanking_sequences | cctatgactatcagtagttcacatttagtcacgcgtagggggaacctct | ataagaaatcacagggaacagcgaaacggt | ||||||
Mapping_target | F52C12 | |||||||
Source_location | 7 | CHROMOSOME_IV | 1927502 | 1927823 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AAGAA | ||||||
Deletion | ||||||||
PCR_product | tm6437_external | |||||||
tm6437_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6437 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018681 | ||||||
Transcript | F52C12.4d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F52C12.4d.1:c.433-148_604delinsAAGAA | |||||||
cDNA_position | ?-604 | |||||||
CDS_position | ?-604 | |||||||
Protein_position | ?-202 | |||||||
Intron_number | 3/21 | |||||||
Exon_number | 4/22 | |||||||
F52C12.4h.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F52C12.4h.1:c.433-148_604delinsAAGAA | |||||||
cDNA_position | ?-604 | |||||||
CDS_position | ?-604 | |||||||
Protein_position | ?-202 | |||||||
Intron_number | 3/21 | |||||||
Exon_number | 4/22 | |||||||
F52C12.4g.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F52C12.4g.1:c.433-148_604delinsAAGAA | |||||||
cDNA_position | ?-610 | |||||||
CDS_position | ?-604 | |||||||
Protein_position | ?-202 | |||||||
Intron_number | 4/23 | |||||||
Exon_number | 5/24 | |||||||
F52C12.4c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F52C12.4c.1:c.433-148_604delinsAAGAA | |||||||
cDNA_position | ?-604 | |||||||
CDS_position | ?-604 | |||||||
Protein_position | ?-202 | |||||||
Intron_number | 3/21 | |||||||
Exon_number | 4/22 | |||||||
F52C12.4f.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F52C12.4f.1:c.433-148_604delinsAAGAA | |||||||
cDNA_position | ?-604 | |||||||
CDS_position | ?-604 | |||||||
Protein_position | ?-202 | |||||||
Intron_number | 3/20 | |||||||
Exon_number | 4/21 | |||||||
F52C12.4b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F52C12.4b.1:c.433-148_604delinsAAGAA | |||||||
cDNA_position | ?-611 | |||||||
CDS_position | ?-604 | |||||||
Protein_position | ?-202 | |||||||
Intron_number | 4/22 | |||||||
Exon_number | 5/23 | |||||||
F52C12.4a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F52C12.4a.1:c.433-148_604delinsAAGAA | |||||||
cDNA_position | ?-604 | |||||||
CDS_position | ?-604 | |||||||
Protein_position | ?-202 | |||||||
Intron_number | 3/21 | |||||||
Exon_number | 4/22 | |||||||
F52C12.4e.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F52C12.4e.1:c.433-148_604delinsAAGAA | |||||||
cDNA_position | ?-611 | |||||||
CDS_position | ?-604 | |||||||
Protein_position | ?-202 | |||||||
Intron_number | 4/22 | |||||||
Exon_number | 5/23 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal or sterile by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal or sterile by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 9536/9537-AAGAA-9856/9857 (320 bp deletion + 5 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |