WormBase Tree Display for Variation: WBVar01474473
expand all nodes | collapse all nodes | view schema
| WBVar01474473 | Evidence | Paper_evidence | WBPaper00041593 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e2636 | |||||
| Other_name | Y41C4A.13.1:c.173delinsA | ||||||
| CE20253:p.Trp58Ter | |||||||
| HGVSg | CHROMOSOME_III:g.11737396delinsT | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y41C4A | |||
| Flanking_sequences | aatgcggaacctctagcatcttccactact | aaatgctgtggagaactcaacaaggaatgc | |||||
| Mapping_target | Y41C4A | ||||||
| Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00041593 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004632 | ||||||
| WBStrain00033410 | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Linked_to | WBVar02145284 | ||||||
| Affects | Gene | WBGene00012759 | |||||
| Transcript | Y41C4A.13.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | Y41C4A.13.1:c.173delinsA | ||||||
| HGVSp | CE20253:p.Trp58Ter | ||||||
| cDNA_position | 187-188 | ||||||
| CDS_position | 173-174 | ||||||
| Protein_position | 58 | ||||||
| Exon_number | 3/5 | ||||||
| Codon_change | tGG/tAG | ||||||
| Amino_acid_change | W/* | ||||||
| Genetics | Interpolated_map_position | III | 12.0485 | ||||
| Reference | WBPaper00041593 | ||||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00012759 Amber_UAG_or_Opal_UGA | ||||||
| Method | Substitution_allele |
