WormBase Tree Display for Variation: WBVar01474474
expand all nodes | collapse all nodes | view schema
WBVar01474474 | Evidence | Paper_evidence | WBPaper00042462 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | dp253 | |||||
Other_name | CE26205:p.Met1293Lys | ||||||
Y59A8B.1a.1:c.3878T>A | |||||||
HGVSg | CHROMOSOME_V:g.17940929A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | |||
Flanking_sequences | tgatcatgcagcgcttctgccgcattttcc | ttactccgatggcaaataggggtactccat | |||||
Mapping_target | Y59A8B | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | BQ | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001080 | |||||
Transcript | Y59A8B.1a.1 (12) | ||||||
Genetics | Interpolated_map_position | V | 13.3322 | ||||
Reference | WBPaper00042462 | ||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |