WormBase Tree Display for Variation: WBVar02122322
expand all nodes | collapse all nodes | view schema
WBVar02122322 | Name | Public_name | WBVar02122322 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853245 | |||||||
Sequence_details | SMap | S_parent | Sequence | K08E3 | ||||
Flanking_sequences | TTGAGAATAGAAAGATCCACGGTAGCTCCC | AAAATGTAATTTCAGCAACCAATGTCTCTT | ||||||
Mapping_target | K08E3 | |||||||
Source_location | 225 | CHROMOSOME_III | 13765001 | 13775000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006645 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00022852 | From_analysis | Million_mutation_project_reanalysis | ||||||
WBStrain00023018 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00007025 | ||||||
WBGene00003967 | ||||||||
WBGene00197401 | ||||||||
WBGene00010665 | ||||||||
WBGene00000875 | ||||||||
WBGene00045172 | ||||||||
Transcript (16) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |