WormBase Tree Display for Variation: WBVar02123328
expand all nodes | collapse all nodes | view schema
WBVar02123328 | Name | Public_name | WBVar02123328 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854251 | |||||||
HGVSg | CHROMOSOME_X:g.3073011_3083010del | |||||||
Sequence_details | SMap | S_parent | Sequence | F52E4 | ||||
Flanking_sequences | CGATAACCGCGCCTCCGGCGCGGCCAACGA | AACTACAACTATGAAGACATTAACTGAGCG | ||||||
Mapping_target | F52E4 | |||||||
Source_location | 225 | CHROMOSOME_X | 3073001 | 3083000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022850 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006670 | ||||||
WBGene00197203 | ||||||||
WBGene00197807 | ||||||||
Transcript | F52E4.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-4/13 | |||||||
Exon_number | 1-4/14 | |||||||
F52E4.10 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
F52E4.11 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |