WormBase Tree Display for Variation: WBVar02123329
expand all nodes | collapse all nodes | view schema
WBVar02123329 | Name (2) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | C15C7 | ||||
Flanking_sequences | TTTCAATTCCTAACTAAAAGCTCACTTCAT | TACAAGCAGAAAGACAGAAACTTGCGTTAT | ||||||
Mapping_target | C15C7 | |||||||
Source_location | 225 | CHROMOSOME_X | 3159301 | 3159976 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022850 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00201126 | ||||||
WBGene00002220 | ||||||||
Transcript | C15C7.12 | |||||||
C15C7.2.1 | ||||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |